fis1 shrna  (Santa Cruz Biotechnology)

Journal: Scientific Reports

Article Title: A role for Fis1 in dendritic development

doi: 10.1038/s41598-025-33557-8

Figure Lengend Snippet: Fis1 knockdown results in shorter dendritic mitochondria both in vitro and in vivo. ( a ) Representative basal dendritic segments from 17DIV cortical neurons showing mitochondrial morphology and dendrite structure via matrix targeted YFP and cytosolic tdTomato respectively for each of the labeled conditions. ( b ) Representative basal dendritic segments from P21 layer 2/3 cortical neurons showing mitochondrial morphology and dendrite structure via matrix targeted YFP and cytosolic tdTomato respectively for each of the labeled conditions in vivo. ( c ) Quantification of mitochondrial lengths in vitro for each of the indicated conditions demonstrating that loss of Fis1 results in shorter dendritic mitochondria. ( d ) Quantification of mitochondrial lengths for each of the indicated conditions demonstrating that loss of Fis1 in vivo recapitulates the mitochondrial phenotype observed in cultured neurons. Control in vitro = 3 independent cultures, 516 mitochondria; Fis1 386 shRNA in vitro = 4 independent cultures, 856 mitochondria; Fis1 C shRNA in vitro = 3 independent cultures, 250 mitochondria; Fis1 386 shRNA + Fis1 HA imp rescue in vitro = 2 independent cultures, 904 mitochondria; CRISPR control in vitro = 3 independent cultures, 935 mitochondria; CRISPR KO in vitro = 4 independent cultures, 1087 mitochondria; Control in vivo = 3 independent brains, 94 mitochondria; Fis1 386 shRNA in vivo = 3 independent brains, 275 mitochondria; Fis1 C shRNA in vivo = 3 independent brains, 220 mitochondria. p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25th, 50th and 75th percentiles indicated with whiskers indicating min and max values. Large dots depict the averages of biological replicates. Scale bars, 3 μm in a, 6 μm in b.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Knockdown, In Vitro, In Vivo, Labeling, Cell Culture, Control, shRNA, CRISPR

Journal: Scientific Reports

Article Title: A role for Fis1 in dendritic development

doi: 10.1038/s41598-025-33557-8

Figure Lengend Snippet: Loss of Fis1 activity increases both mitochondria motility and mitochondrial dynamics. ( a ) Photo-activated mitochondria in a control basal dendrite at t = 0 (red) and at t = 15 min (green). The merged images showing overlap of the two timepoints and a kymograph of the entire 15 min imaging session demonstrating little dendritic mitochondria movement in mature dendrites. ( b , c ) Photo-activated mitochondria in a Fis1 386 shRNA ( b ) or Fis1 C shRNA ( c ) basal dendrite at t = 0 (red) and at t = 15 min (green). The merge images showing overlap of the two timepoints and a kymograph of the entire 15 min imaging session demonstrating increased mitochondria motility following Fis1 knockdown. ( d ) Pie graphs showing percentages of stationary (dotted area), oscillating (checkered area), and motile (filled area) mitochondria in the dendrites of labeled conditions. ( e ) Quantification of motile mitochondria percentage for dendrite segments demonstrating increased motility in Fis1 knockdown neurons. ( f ) Scheme for photo-activation experiments to quantify fission and fusion dynamics in neuronal dendrites. ( g ) Quantification of dendritic mitochondria fission and fusion rates as events per 15 min for control and knockdown dendrites showing that both fission and fusion are increased upon Fis1 loss in neurons. Control motility = 37 basal dendrite segments, 663 mitochondria; Fis1 386 shRNA motility = 15 basal dendrite segments, 279 mitochondria; Fis1 C shRNA motility = 19 basal dendrite segments, 351 mitochondria; Control dynamics = 35 basal dendrite segments, 39 fission events, 57 fusion events; Fis1 386 shRNA dynamics = 31 basal dendrite segments, 75 fission events, 90 fusion events; Fis1 C shRNA dynamics = 30 basal dendrite segments, 64 fission events, 57 fusion events (All with 3 independent cultures). p values are indicated in the figure following Kruskal-Wallis tests. Data are shown as individual points on box plots with 25th, 50th and 75th percentiles indicated with whiskers indicating min and max values for e, or individual points with mean ± SEM for g. Scale bars, 5 μm.

Article Snippet: Fis1 C shRNA plasmid was ordered from Origene (pGFP-C-shLenti clone C, target sequence: CCAAGGAGCTGGAACGCCTGATTGATAAG).

Techniques: Activity Assay, Control, Imaging, shRNA, Knockdown, Labeling, Activation Assay

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: FIS1 interacts with EPEC EspZ. A, β-galactosidase activity of S. cerevisiae NMY32 expressing the ‘bait’ EspZ-Cub-LexA-VP16 and NubG (negative control), NubI (positive control), or FIS1-NubG; cells expressing either ‘bait’ (EspZ-Cub-LexA-VP16) alone or ‘prey’ (FIS1-NubG) alone were included as negative controls. Chart shows mean β-galactosidase units in yeast extracts normalized for protein concentration (n = 3) and is representative of three independent experiments. * denotes p value < 0.0002 for NubG-FIS1 + EspZ-Cub-LexA-VP16 compared to FIS1-NubG, EspZ-Cub-LexA-VP16 alone, or NubG + EspZ-Cub-LexA-VP16. B & C, HeLa cells were mock-treated or transiently transfected with a plasmid expressing HA-tagged EspZ (EspZ HA ) or empty vector control. At 72-hours post-transfection, total protein extracts from mock-treated and transfected cells were immunoprecipitated using α-FIS1 antibodies (b) or α-HA antibodies (c), and extracts and precipitates blotted for FIS1 or HA. Images shown are representative of three independent experiments. B (right panel), chart depicts densitometry analysis of co-immunoprecipitated HA-EspZ normalized against the bait antibody target FIS1. C (right panel), chart depicts co-immunoprecipitated FIS1 normalized against the total FIS1 in extract.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Activity Assay, Expressing, Negative Control, Positive Control, Protein Concentration, Transfection, Plasmid Preparation, Control, Immunoprecipitation

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: EPEC EspZ colocalizes with mitochondrial fission protein FIS1. C2 BBe and HeLa transfected with espZ- encoding plasmid (pEspZ HA ) were fixed and stained for FIS1 (green) and EspZ (magenta). DNA was stained with 4,6- diamidino-2-phenylindole (DAPI; blue). Scale bar: 15 μm (C2 BBe ; top panels) and 10 μm (HeLa; bottom panels). Images shown are representative of >6 images captured from three independent experiments. Overlapping staining of FIS1 and EspZ was confirmed by positive Pearson correlation coefficients of 0.486 ± (C2 BBe ) and 0.795 (HeLa).

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Transfection, Plasmid Preparation, Staining

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: EPEC infection increases FIS1 levels. C2 BBe cells were mock-treated or infected with WT EPEC, ∆ espZ , or cis-espZ . A, Immunofluorescence staining of mock-treated or infected C2 BBe for FIS1 (magenta); DNA was stained with DAPI (blue). Scale bar: 10 μm. Images shown are representative of >6 images captured from three independent experiments. Exposure time and light transmittance were maintained for all image captures. B, Total protein extracts from mock-treated or infected C2 BBe cells were blotted for FIS1. Actin was used as a loading control. Image shown is representative of five independent experiments. The chart depicts densitometry analysis of FIS1 abundance normalized to actin. * denotes p value < 0.0001 for specific sample group compared to mock.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Infection, Immunofluorescence, Staining, Control

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: FIS1 depletion protects against EPEC-induced mitophagy. HeLa cells were mock-treated, or transfected with FIS1 shRNA or Scramble shRNA. A, At 7 days post-transfection, total protein extracts from un-transfected and shRNA-transfected HeLa were immunoblotted for FIS1. Actin was blotted as a loading control. Chart depicts densitometry analyses of FIS1 abundance normalized against actin. B, HeLa cells (untransfected or transfected with FIS1 shRNA or Scramble shRNA) were fixed and stained for FIS1 (green), COXIV (magenta) and DAPI (blue). Scale bar: 10 μm. C, HeLa cells transfected with FIS1 shRNA and Scramble shRNA control were mock-treated or infected with EPEC or Δ espZ . Cells were fixed, and then stained for LC3 (green), COXIV (magenta) and DAPI (blue). Scale bar: 20 μm. Regions in hatched rectangles were enlarged in lower panels. Images shown are representative of >6 images captured from two independent experiments. Chart depicts Pearson correlation coefficients of LC3 colocalized to COXIV.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Transfection, shRNA, Control, Staining, Infection

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: FIS1 depletion curtails EPEC-induced host cell death. HeLa cells were transfected with FIS1 shRNA or Scramble shRNA. At 7 days post-transfection, cells were infected with Δ espZ at a multiplicity of infection of 100. At 1-hour post-infection, unattached bacteria were removed. Host cell death was then measured via propidium iodide (PI) uptake at 3 hours. Chart shown is representative of 3 independent experiments (n = 5 per sample group). * denotes p value <0.0001 and ** denotes p value < 0.05 for specific group comparisons in brackets.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Transfection, shRNA, Infection, Bacteria

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: EspH increases FIS1 levels and promotes mitochondrial fission. C2 BBe cells were mock-treated or infected with WT EPEC, ∆ espH , or p espH . A, Total protein extracts from mock-treated or infected C2 BBe cells were blotted for FIS1. Actin was blotted as a loading control. Image shown is representative of four independent replicates. Chart depicts densitometry analyses of FIS1 abundance normalized against actin. * denotes p value <0.0001 and ** denotes p value < 0.05 for specific group comparisons in brackets. B, Transmission electron micrographs of mock-treated (left-most panel) or infected C2 BBe showing mitochondria (yellow arrows). Scale bar: 500 nm. Images are representative of >6 fields captured per sample from two independent experiments. C, Mock-treated or infected C2 BBe were stained for COXIV (magenta) and DAPI (blue). Scale bar: 10 μm. Regions in hatched rectangles were enlarged in lower panels. Images shown are representative of >6 images captured from three independent experiments.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Infection, Control, Transmission Assay, Staining

Journal: Gut Microbes

Article Title: Enteropathogenic Escherichia coli regulates host-cell mitochondrial morphology

doi: 10.1080/19490976.2022.2143224

Figure Lengend Snippet: List of plasmids.

Article Snippet: FIS1 knockdown was confirmed via immunoblotting using α-FIS1 as the primary antibody (Santa Cruz Biotechnology, Dallas, TX).

Techniques: Plasmid Preparation, Expressing, Control, Clone Assay, shRNA, Negative Control